International Journal of Pediatrics
Hu Wei1, Gao Feng2, Wang Pei1, Wang Gang1 and Zhang Yuelin1*
1Emergency Surgery, Shaanxi Provincial People’s Hospital, Xi'an, PR China
2Emergency Department, Shaanxi Provincial Pucheng Hospital, Xi'an, PR China
Accepted on September 06, 2017
We conducted a case-control study to evaluate the correlation of IL-4 rs2243250 and rs2070874 polymorphisms with the risk of cerebral infarction, and the gene-environmental interaction between IL-4 and environmental factors. A total of 344 patients with cerebral infarction and 360 healthy controls were enrolled in this case-control study. The genotyping of the IL-4 rs2243250 and rs2070874 was performed by Polymerase Chain Reaction (PCR) amplification and single base extension assays in a 384- well plate format on the sequenom MassARRAY platform. By logistic regression analysis, males (OR=1.44, 95% CI=1.07-2.02), creatinine ≥ 1.00 (OR=1.74, 95% CI=1.28-2.38), a history of hypertension (OR=1.64, 95% CI=1.18-2.30) and diabetes mellitus (OR=1.76, 95% CI=1.14-2.73), and high level of HDL-c (OR=2.95, 95% CI=1.46-5.97) were associated with an increased risk of cerebral infarction when compared with the reference group. We observed that the TT (OR=3.32, 95% CI=1.81-6.06) and CT+TT (OR=1.51, 95% CI=1.11-2.06) genotypes of rs2243250 were correlated with a higher risk of cerebral infarction in comparison with the CC genotype. The rs2243250 had interaction with gender and HDL-c in the risk of cerebral infarction. In conclusion, our study suggests that rs2243250 may be considered as a useful biomarker for prediction of the susceptibility of cerebral infarction.
Cerebral infarction, IL-4, rs2243250, rs2070874, Polymorphism.
Stroke is the majority cause of death in the elderly, and it causes about 11% of all death worldwide and is the most common reason for adult-acquired disability [1]. Cerebral infarction constitutes about 50% of all stroke cases [2]. Cerebral infarction has a diverse etiology, and several risk factors contribute to the pathogenesis of cerebral infarction, such as long term tobacco smoking and alcohol drinking, lack of exercises, obesity and a history of type 2 diabetes, and adiposity as well [2].
However, the prevalence of cerebral infarction varies across different population worldwide even when they had similar environmental factors, suggesting that genetic factors would play a critical role in the risk of cerebral infarction [3].
Previous studies have reported the association between genetic polymorphisms and risk of cerebral infarction in various populations, LOX-1, Apolipoprotein E4, interleukin-10 and transforming growth factor Beta-1 genes [4-7].
Currently, it is reported that a various inflammatory mechanisms contribute to the development of cerebral infarction [8-10]. Several kinds of inflammatory factors, such as tumor necrosis factor (TNF-alpha), interleukin (IL)-1 and IL-6, are produced by cultured brain cells after obtaining various stimuli [10].
Neurones, astrocytes, microglia cells and oligodendrocytes could produce inflammatory mediators, although the cytokine receptors in central nervous system are expressed at a relatively low level [10]. These inflammatory genes are associated with increased risk of ischemic injury through rapid activation of resident cells, production of pro-inflammatory mediators and infiltration of various types of inflammatory cells [11].
IL-4 is a typical cytokine of T helper 2 (Th2) cells, which could inhibit effect on the inflammation, decrease the production of pro-inflammatory cytokines and reduce the destructive enzymes through monocytes [12]. A previous study reported an increased serum levels of IL-4 originated from Th2 cells in patients with stroke in the course of the acute stage [13].
Only a few studies reported the association of IL-4 polymorphisms with the pathogenesis of cerebral infarction [14]. In this study, we conducted a case-control study to evaluate the correlation of IL-4 rs2243250 and rs2070874 polymorphisms with the risk of cerebral infarction, and the gene-environmental interaction between IL-4 and environmental factors.
Subjects
Three hundred and forty-four participants with cerebral infarction were recruited from patients who visited the Shaanxi Provincial People's Hospital between June 2015 and June 2016. The diagnosis of cerebral infarction was confirmed by neurological examination, Computed Tomography (CT) and Magnetic Resonance Imaging (MRI) examinations, based on the diagnostic criteria from World Health Organization. Patients with other causes of cerebrovascular events such as brain trauma, vascular malformation, brain tumors or congenital brain disorders were excluded.
Between June 2015 and June 2014, 360 healthy subjects were selected through a general health check-up of the Shaanxi Provincial People's Hospital, and they are considered as controls. These respondents received CT and MRI, and were confirmed to be free of cerebral infarction.
The exclusion for controls was those with a history of stroke, brain tumors, brain trauma, cardiovascular diseases, autoimmune diseases or any severe diseases. The protocol of this study was approved by the ethics review committee of the Shaanxi Provincial People's Hospital. All respondents voluntary agreed to join in this study and signed informed consents.
The lifestyle characteristics and family history of diseases of respondents were obtained from self-designed questionnaires, including alcohol drinking and tobacco smoking habits, and a history of hypertension and diabetes mellitus.
The clinical variables were collected from medical records, including creatinine, Total Cholesterol (TC), Low Density Lipopolysaccharide Cholesterol (LDL-c), High Density Lipopolysaccharide Cholesterol (HDL-c) and Triglyceride (TG).
The body mass index was defined as the weight divided by the square of the body height. The hypertension was defined as systolic pressure ≥ 140 mmHg and diastolic pressure ≥ 90 mmHg. The type-2 diabetes was defined as fasting plasma glucose ≥ 7.0 mmol/L or two hours after the oral dose a plasma glucose ≥ 11.1 mmol/L by a glucose tolerance test.
The ever drinking was defined as those who drank more than 50 g white wine or 200 g beer per week and lasted for one year. The tobacco smoking was considered as those who smoked more than one cigarette per day and lasted for one year.
The mean ages of patients with cerebral infarction and controls were 58.15 ± 10.45 and 58.47 ± 9.43 years, respectively; the mean BMI values were 23.11 ± 2.01 and 22.45 ± 2.31 kg/m2, respectively; and the creatinine levels were 0.92 ± 0.26 and 1.02 ± 0.28 mg/dl, respectively.
Genotyping assays
5 ml peripheral platform (Sequenom, San Diego, USA); the sense and antisense primers for genotyping IL-4 rs2243250 and rs2070874 is shown in Table 1. The PCR of IL-4 rs2243250 and rs2070874 was carried out in a 5 μL mixture reaction, and then the SAP and iPLEX reaction was conducted.
| SNPs | Sense (3'-5') | Antisense (3'-5') |
|---|---|---|
| rs2243250 | AATTCAGGGTCCCTGACACACT | AACCTCCCTTCAAGGTTGTACA |
| rs2070874 | AATTTCTCCTCCAAGAGAGGT | CTGAGAGCATTAGGAGAACA |
Table 1. Primers for IL-4 rs2243250 and rs2070874.
The PCR products are then desalted venous blood sample was obtained from each respondent after enrolment. Genomic DNA was isolated from the blood serum through a TIANamp Blood DNA Kit (Tiangen, Beijing, China), and kept at -20°C when use. Genotyping of IL-4 rs2243250 and rs2070874 was conducted by Polymerase Chain Reaction (PCR) amplification and single base extension assays. Genotyping of the two SNPs of IL-4 was performed in a 384-well plate format on the sequenom MassARRAY, dispensed to a SpectroCHIP and analyzed with MALDI-TOF MS.
Statistical analysis
The chi-square test or Fisher’s exact test were used for comparison of categorical variables, including demographic and lifestyle variables and allele and genotype frequencies. Student t-test was used to comparison of continued variables, such as clinical variables. Chi-square test with one degree of freedom was used to estimate the Hardy-Weinberg Equilibrium (HWE) for IL-4 rs2243250 and rs2070874 genotype distributions. The association of environmental factors, rs2243250 and rs2070874 polymorphisms with cerebral infarction risk was estimated by unconditional logistic regression analysis and the results were displayed by adjusted Odds Ratio (OR) and 95% Confident Intervals (95% CI). Gene-environmental interaction was performed by Chi-square test. The statistical analyses were performed by SPSS Statistics for Windows, version 20.0 (IBM Corp, Armonk, NY, USA), and all P values were two tailed. The OR (95% CI) was adjusted for potential confounding factors, including gender and age.
By Chi-square test or student t test, we observed significant differences between patients and controls in terms of gender (χ2=7.61, P=0.006), creatinine (t=13.65, P<0.001), hypertension (χ2=8.63, P=0.003), diabetes mellitus (χ2=7.22, P=0.007) and HDL-c (t=1.14, P=0.255) (Table 2). However, no significant differences were found in age, BMI, alcohol drinking, tobacco smoking, and levels of TC, LDL-c and TG (All P>0.05).
| Variables | Patients N=344 | % | Controls N=360 | % | χ2-test or t-test | P value |
|---|---|---|---|---|---|---|
| Age, year | ||||||
| <60 | 200 | 58.14 | 211 | 58.61 | ||
| ≥ 60 | 144 | 41.86 | 149 | 41.39 | 0.02 | 0.899 |
| Gender | ||||||
| Females | 117 | 34.01 | 159 | 44.17 | ||
| Males | 227 | 65.99 | 201 | 55.83 | 7.61 | 0.006 |
| BMI, kg/m2 | ||||||
| <24 | 238 | 69.19 | 266 | 73.89 | ||
| ≥ 24 | 106 | 30.81 | 94 | 26.11 | 1.91 | 0.167 |
| Creatinine, mg/dl | ||||||
| <1.00 | 131 | 38.08 | 187 | 51.94 | ||
| ≥ 1.00 | 213 | 61.92 | 173 | 48.06 | 13.65 | <0.001 |
| Alcohol drinking | ||||||
| Never | 154 | 44.77 | 179 | 49.72 | ||
| Ever | 190 | 55.23 | 181 | 50.28 | 1.73 | 0.188 |
| Tobacco smoking | ||||||
| Never | 145 | 42.15 | 159 | 44.17 | ||
| Ever | 199 | 57.85 | 201 | 55.83 | 0.29 | 0.589 |
| Hypertension | ||||||
| No | 221 | 64.24 | 268 | 74.44 | ||
| Yes | 123 | 35.76 | 92 | 25.56 | 8.63 | 0.003 |
| Diabetes mellitus | ||||||
| No | 280 | 81.4 | 319 | 88.61 | ||
| Yes | 64 | 18.6 | 41 | 11.39 | 7.22 | 0.007 |
| TC, mmol/L | 4.57 ± 1.04 | 4.50 ± 1.03 | 0.79 | 0.429 | ||
| LDL-c, mmol/L | 2.27 ± 0.42 | 2.26 ± 0.44 | 0.31 | 0.759 | ||
| HDL-c, mmol/L | 1.22 ± 0.25 | 1.17 ± 0.20 | 3.14 | 0.002 | ||
| TG, mmol/L | 2.37 ± 1.16 | 2.27 ± 1.13 | 1.14 | 0.255 | ||
TC: Total Cholesterol; LDL-c: Low Density Lipopolysaccharide cholesterol; HDL-c: High Density Lipopolysaccharide cholesterol; TG: Triglyceride.
Table 2. Baseline characteristics of study subjects.
The CC, CT and TT genotypes frequencies of IL-4 rs2243250 showed significant differences between patients and controls (χ2=18.93, P<0.001). However, no significant difference was found in the genotype distributions of IL-4 rs2070874 (χ2=0.81, P=0.67) between the two study groups. The genotype frequencies of IL-4 rs2243250 and rs2070874 were according to the HWE in both patients and controls (Table 3).
| SNP | CAD patients | % | Controls | % | Chi-square | P value | HWE in patients | P value | HWE in controls | P value |
|---|---|---|---|---|---|---|---|---|---|---|
| rs2243250 | ||||||||||
| CC | 143 | 41.57 | 186 | 51.67 | ||||||
| CT | 153 | 44.48 | 156 | 43.33 | ||||||
| TT | 48 | 13.95 | 18 | 5 | 18.93 | <0.001 | 0.47 | 0.49 | 4.76 | 0.06 |
| rs2070874 | ||||||||||
| TT | 135 | 39.24 | 151 | 41.94 | ||||||
| TC | 142 | 41.28 | 147 | 40.83 | ||||||
| CC | 67 | 19.48 | 62 | 17.22 | 0.81 | 0.67 | 2.62 | 0.11 | 3.25 | 0.08 |
Note: Adjusted for gender, age, BMI, creatinine, hypertension, diabetes mellitus and HDL-c.
Table 3. Genotype distributions of IL-4 rs2243250 and rs2070874 in study subjects.
The unconditional logistic regression analyses showed that males (OR=1.44, 95% CI=1.07-2.02), creatinine ≥ 1.00 (OR=1.74, 95% CI=1.28-2.38), a history of hypertension (OR=1.64, 95% CI=1.18-2.30) and diabetes mellitus (OR=1.76, 95% CI=1.14-2.73), and high level of HDL-c (OR=2.95, 95% CI=1.46-5.97) were associated with an increased risk of cerebral infarction when compared with the reference group. When compared with the CC genotype, we observed that the TT (OR=3.32, 95% CI=1.81-6.06) and CT+TT (OR=1.51, 95% CI=1.11-2.06) genotypes of rs2243250 were correlated with a higher risk of cerebral infarction (Table 4). However, rs2070874 polymorphism could not influence the cerebral infarction risk.
| Variable | B | S.E | Wald | P value | OR (95% CI) |
|---|---|---|---|---|---|
| Age ≥ 60, y | 0 | 0.16 | 0 | 0.976 | 0.98 (0.73-1.36) |
| Males | 0.39 | 0.16 | 5.78 | 0.016 | 1.44 (1.07-2.02) |
| BMI ≥ 24, kg/m2 | 0.19 | 0.17 | 1.15 | 0.284 | 1.21 (0.86-1.70) |
| Creatinine ≥ 1.00, mg/dl | 0.56 | 0.16 | 12.43 | 0 | 1.74 (1.28-2.38) |
| Ever alcohol drinking | 0.21 | 0.16 | 1.79 | 0.181 | 1.21 (0.91-1.68) |
| Ever tobacco smoking | 0.02 | 0.16 | 0.02 | 0.892 | 1.01 (0.75-1.40) |
| A history of hypertension | 0.5 | 0.17 | 8.46 | 0.004 | 1.64 (1.18-2.30) |
| A history of diabetes mellitus | 0.57 | 0.22 | 6.41 | 0.011 | 1.76 (1.14-2.73) |
| TC, mmol/L | 0.06 | 0.08 | 0.53 | 0.467 | 1.06 (0.91-1.23) |
| LDL-c, mmol/L | 0.09 | 0.18 | 0.22 | 0.637 | 1.12 (0.78-1.61) |
| HDL-c, mmol/L | 1.04 | 0.35 | 8.61 | 0.003 | 2.95 (1.46-5.97) |
| TG, mmol/L | 0.07 | 0.07 | 1.04 | 0.308 | 1.08 (0.94-1.24) |
| rs2243250 | |||||
| CC | 15.46 | 0 | 1.0 | ||
| CT | 0.26 | 0.17 | 2.4 | 0.122 | 1.29 (0.93-1.79) |
| TT | 1.2 | 0.31 | 15.16 | 0 | 3.32 (1.81-6.06) |
| CT+TT | 0.41 | 0.16 | 6.78 | 0.009 | 1.51 (1.11-2.06) |
| rs2070874 | |||||
| TT | 0.43 | 0.805 | 1.0 | ||
| TC | 0.1 | 0.18 | 0.29 | 0.59 | 1.10 (0.78-1.55) |
| CC | 0.13 | 0.22 | 0.32 | 0.572 | 1.14 (0.73-1.76) |
| TC+CC | 0.09 | 0.16 | 0.31 | 0.58 | 1.12 (0.81-1.53) |
Table 4. Association between IL-4 rs2243250 and rs2070874 polymorphisms and cerebral infarction risk.
The gene-environmental interaction was performed in terms of gender, creatinine, hypertension, diabetes mellitus and HDL-c. We observed that the rs2243250 had interaction with gender and HDL-c in the risk of cerebral infarction (Table 5).
| Variables | Patients | χ2 | P value | Controls | χ2 | P value | ||
|---|---|---|---|---|---|---|---|---|
| CC | TT+CT | CC | TT+CT | |||||
| Gender | ||||||||
| Females | 48 | 69 | 93 | 66 | ||||
| Males | 95 | 132 | 0.02 | 0.88 | 93 | 108 | 5.31 | 0.02 |
| Creatinine, mg/dl | ||||||||
| <1.00 | 55 | 76 | 94 | 93 | ||||
| ≥ 1.00 | 88 | 125 | 0.02 | 0.9 | 92 | 81 | 0.31 | 0.58 |
| Hypertension | ||||||||
| No | 94 | 127 | 135 | 133 | ||||
| Yes | 49 | 74 | 0.24 | 0.63 | 51 | 41 | 0.7 | 0.4 |
| Diabetes mellitus | ||||||||
| No | 116 | 164 | 163 | 156 | ||||
| Yes | 27 | 37 | 0.01 | 0.91 | 23 | 18 | 0.36 | 0.55 |
| HDL-c, mmol/L | ||||||||
| <1.10 | 44 | 67 | 59 | 77 | ||||
| ≥ 1.10 | 99 | 134 | 0.25 | 0.62 | 127 | 97 | 6.01 | 0.02 |
Table 5. Gene-environmental interaction between IL-4 rs2243250 and environmental factors in the risk of cerebral infarction.
Our results investigated the correlation between IL-4 rs2243250 and rs2070874 polymorphisms and the pathogenesis of cerebral infarction. We found that the rs2243250 TT and CT +TT genotypes were correlated with an elevated risk of cerebral infarction in the Chinese population, and rs2243250 polymorphism had an interaction with gender and HDL-c in the risk of this disease.
It has been long accepted that imbalanced T-helper immune responses play an important role in the development of cerebral infarction. IL-4 cytokine is a prototypic member of the T helper (Th2), and contributes a major part in Th1/Th2 cytokine balance regulation. Many experimental studies have reported an association between IL-4 expression and pathogenesis of stroke [15-17]. Zhao has reported that IL-4 expression is secreted by ischemic neurons as an endogenous defense mechanism, which contributes to the regulation of brain clean-up and repair after stroke [16]. Liu et al. have indicated that cytokine IL-4 promotes the long term neurological outcomes after stroke, and the mechanism might be through M2 phenotype induction by microglia/macrophages [17]. Theodorou et al. showed a significant increase in the percentage of IL-4 producing T cells in the ischaemic stroke, compared with the controls [18]. Katsuno have reported that the intracerebral IL-4 is negatively associated with the severity of cerebral diseases, and secretion of IL-4 shows a neuro-protective effect and could be considered as a predictive factor for the outcome of stroke [19].
Single nucleotide polymorphisms mean DNA sequence polymorphisms induced by a single nucleotide variation, such as transversion, insertion or deletion [20]. The IL-4 polymorphisms may influence the expression of cytokine production levels, and thus influence the development of many inflammation-related diseases. Currently, only several studies have reported the association between IL-4 polymorphisms and risk of stroke and cardiovascular diseases [21-25]. Tong et al. performed a study with 100 ischemic stroke and 100 matched healthy controls, and reported that IL-4 VNTR polymorphism was significantly associated with ischemic stroke in the Chinese Uyghur population [21]. Park et al. performed a study with 119 patients with ischaemic stroke, 79 patients with intracerebral haemorrhage and 267 controls in Korean population, and they reported that both the rs2243250 and rs2070874 polymorphisms and their haplotypes were correlated with intracerebral haemorrhage [22]. Marousi et al. performed a study with 290 subjects, and suggested that IL-4 rs2243250 genotype was associated with the recurrences of ischaemic stroke after adjusted for potential confounding factors [24]. Our study also indicated a significant relationship between rs2243250 TT and CT+TT genotypes and increased risk of cerebral infarction in a Chinese population. However, no previous study reported the association of IL-4 rs2243250 and rs2070874 polymorphisms with the cerebral infarction risk in a Chinese population. Therefore, further studies are greatly needed to confirm our findings.
Our study found an interaction of IL-4 rs2243250 with males and HDL-c in the risk of cerebral infarction. Golimbet et al. reported that IL-4 rs2243250 was associated with depression and anxiety in male patients with coronary heart disease, which showed a significant gene-environmental interaction [26]. Ho et al. reported a significant interaction between IL-4 rs2243250 TT genotype and high level of HDL-c in the risk of type 2 diabetes mellitus [27]. These studies suggested that a gene-environment interaction among the IL-4 and males and HDL-c.
Our study suggests that rs2243250 TT and CT+TT genotypes may increase the risk of cerebral infarction when compared with the CC genotype, and rs2243250 could be considered as a useful biomarker for prediction of the susceptibility of cerebral infarction. Further studies with large sample size are necessary to validate our findings.
None.